ID: 1149304779_1149304786

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1149304779 1149304786
Species Human (GRCh38) Human (GRCh38)
Location 17:55336891-55336913 17:55336929-55336951
Sequence CCAGGAAGCATCCAAGGGCTGAG GCCCATAGTGTAGGCAGTTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!