ID: 1149370087_1149370094

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1149370087 1149370094
Species Human (GRCh38) Human (GRCh38)
Location 17:55985355-55985377 17:55985372-55985394
Sequence CCTTCCACTGTGTCCCTCCCATG CCCATGACATGTGGGAATTATGG
Strand - +
Off-target summary {0: 2, 1: 55, 2: 718, 3: 1429, 4: 3219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!