|
Left Crispr |
Right Crispr |
Crispr ID |
1149370087 |
1149370096 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:55985355-55985377
|
17:55985373-55985395
|
Sequence |
CCTTCCACTGTGTCCCTCCCATG |
CCATGACATGTGGGAATTATGGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 138, 1: 846, 2: 2652, 3: 4736, 4: 5710} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|