ID: 1149453173_1149453182

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1149453173 1149453182
Species Human (GRCh38) Human (GRCh38)
Location 17:56766099-56766121 17:56766142-56766164
Sequence CCTCTAAAATGTGCCTTTAAAGG GCCCCGGGAAAGCCTAAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 212} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!