ID: 1149751910_1149751917

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1149751910 1149751917
Species Human (GRCh38) Human (GRCh38)
Location 17:59154497-59154519 17:59154541-59154563
Sequence CCCGCGCTCCGGGAGCGGAGCTC CACACCTCTTCCCTCACCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 109} {0: 1, 1: 0, 2: 4, 3: 53, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!