|
Left Crispr |
Right Crispr |
Crispr ID |
1149752974 |
1149752981 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:59163867-59163889
|
17:59163910-59163932
|
Sequence |
CCAGCCTGGCCAAGATGGGGAAA |
CAAAACTTAGCCTGGCGCCGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 33, 1: 7186, 2: 123187, 3: 200699, 4: 166730} |
{0: 1, 1: 1, 2: 107, 3: 2833, 4: 41689} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|