ID: 1149752975_1149752981

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1149752975 1149752981
Species Human (GRCh38) Human (GRCh38)
Location 17:59163871-59163893 17:59163910-59163932
Sequence CCTGGCCAAGATGGGGAAACCCC CAAAACTTAGCCTGGCGCCGTGG
Strand - +
Off-target summary {0: 19, 1: 4972, 2: 90667, 3: 190702, 4: 209268} {0: 1, 1: 1, 2: 107, 3: 2833, 4: 41689}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!