|
Left Crispr |
Right Crispr |
| Crispr ID |
1149752978 |
1149752981 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:59163891-59163913
|
17:59163910-59163932
|
| Sequence |
CCCGTCTCTACTAAAAATACAAA |
CAAAACTTAGCCTGGCGCCGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 164005, 1: 210050, 2: 126715, 3: 67031, 4: 60843} |
{0: 1, 1: 1, 2: 107, 3: 2833, 4: 41689} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|