|
Left Crispr |
Right Crispr |
| Crispr ID |
1149840509 |
1149840513 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:59960621-59960643
|
17:59960658-59960680
|
| Sequence |
CCCAACATGGTGAAACCTGTCTC |
CAAAAGTTAGCCAGGCGCCGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 19, 2: 49, 3: 58, 4: 232} |
{0: 1, 1: 25, 2: 1129, 3: 21245, 4: 95573} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|