ID: 1150137885_1150137888

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1150137885 1150137888
Species Human (GRCh38) Human (GRCh38)
Location 17:62705620-62705642 17:62705650-62705672
Sequence CCAATACGATTGTGAACAGATGT CCTAGTCGCAGCAACGTTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 151} {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!