ID: 1150192053_1150192054

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1150192053 1150192054
Species Human (GRCh38) Human (GRCh38)
Location 17:63253320-63253342 17:63253334-63253356
Sequence CCTTATACATTCTGCTTATTAAT CTTATTAATCCCTTGACAGATGG
Strand - +
Off-target summary {0: 3, 1: 61, 2: 801, 3: 1324, 4: 2097} {0: 2, 1: 29, 2: 594, 3: 1016, 4: 1000}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!