ID: 1150192053_1150192057

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1150192053 1150192057
Species Human (GRCh38) Human (GRCh38)
Location 17:63253320-63253342 17:63253366-63253388
Sequence CCTTATACATTCTGCTTATTAAT ACATATTTTCTCCCATTCTGTGG
Strand - +
Off-target summary {0: 3, 1: 61, 2: 801, 3: 1324, 4: 2097} {0: 14, 1: 1186, 2: 2537, 3: 3546, 4: 4647}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!