|
Left Crispr |
Right Crispr |
| Crispr ID |
1150192053 |
1150192058 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:63253320-63253342
|
17:63253367-63253389
|
| Sequence |
CCTTATACATTCTGCTTATTAAT |
CATATTTTCTCCCATTCTGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 61, 2: 801, 3: 1324, 4: 2097} |
{0: 34, 1: 2580, 2: 14290, 3: 17857, 4: 10086} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|