ID: 1150192056_1150192057

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1150192056 1150192057
Species Human (GRCh38) Human (GRCh38)
Location 17:63253344-63253366 17:63253366-63253388
Sequence CCTTGACAGATGGATAGTTTGCA ACATATTTTCTCCCATTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 187, 2: 866, 3: 1491, 4: 1864} {0: 14, 1: 1186, 2: 2537, 3: 3546, 4: 4647}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!