ID: 1150286524_1150286533

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1150286524 1150286533
Species Human (GRCh38) Human (GRCh38)
Location 17:63957512-63957534 17:63957535-63957557
Sequence CCCGCAGCTGCCAAGCAGGGAGG GCAAGGGTGAATGAGGCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 387} {0: 1, 1: 0, 2: 2, 3: 19, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!