ID: 1150288969_1150288974

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1150288969 1150288974
Species Human (GRCh38) Human (GRCh38)
Location 17:63970998-63971020 17:63971015-63971037
Sequence CCATCTGCCCTCTGGTCACGTGG ACGTGGGCCCCTGTATGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 171} {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!