ID: 1150306584_1150306587

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1150306584 1150306587
Species Human (GRCh38) Human (GRCh38)
Location 17:64090667-64090689 17:64090694-64090716
Sequence CCATCGGAGCTGAGATCCACGCT CGTGTGTGGCAGCTGCTAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69} {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!