ID: 1150376872_1150376877

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1150376872 1150376877
Species Human (GRCh38) Human (GRCh38)
Location 17:64688733-64688755 17:64688751-64688773
Sequence CCAAACTCCATCTCTAAAAACAA AACAAATAGGCCGGGCACAGTGG
Strand - +
Off-target summary No data {0: 6, 1: 87, 2: 961, 3: 5461, 4: 20441}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!