ID: 1150376872_1150376879

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1150376872 1150376879
Species Human (GRCh38) Human (GRCh38)
Location 17:64688733-64688755 17:64688770-64688792
Sequence CCAAACTCCATCTCTAAAAACAA GTGGCTGACACCTGTAATCCCGG
Strand - +
Off-target summary No data {0: 9, 1: 1240, 2: 3317, 3: 4911, 4: 5370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!