ID: 1150416553_1150416562

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1150416553 1150416562
Species Human (GRCh38) Human (GRCh38)
Location 17:64993478-64993500 17:64993516-64993538
Sequence CCAGCTGTGCCAAGGGGCACACG CAGGGTGCTGGATGAAGAACAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 4, 3: 22, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!