ID: 1150488918_1150488936

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1150488918 1150488936
Species Human (GRCh38) Human (GRCh38)
Location 17:65561354-65561376 17:65561407-65561429
Sequence CCCCGCGCCCACGCCGCGGCTCG TTTCTTTGAAGCGGCTCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 249} {0: 1, 1: 0, 2: 0, 3: 1, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!