ID: 1150503220_1150503228

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1150503220 1150503228
Species Human (GRCh38) Human (GRCh38)
Location 17:65671219-65671241 17:65671267-65671289
Sequence CCACAGGGTGACATCACAGAAAA CTCCCGAAGGGGAAATTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 229} {0: 1, 1: 0, 2: 0, 3: 12, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!