ID: 1150591141_1150591143

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1150591141 1150591143
Species Human (GRCh38) Human (GRCh38)
Location 17:66563782-66563804 17:66563801-66563823
Sequence CCAAATGGAGATGTTTGTACTGT CTGTCTGTGCAGAGGTACGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 167} {0: 1, 1: 0, 2: 1, 3: 8, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!