ID: 1150612822_1150612841

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1150612822 1150612841
Species Human (GRCh38) Human (GRCh38)
Location 17:66747892-66747914 17:66747944-66747966
Sequence CCGAGTGCTGGGCACTGTTCCAG CCCAGAGGAGAGCTGGGAGGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 9, 3: 84, 4: 459} {0: 1, 1: 0, 2: 7, 3: 95, 4: 754}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!