ID: 1150612834_1150612841

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1150612834 1150612841
Species Human (GRCh38) Human (GRCh38)
Location 17:66747926-66747948 17:66747944-66747966
Sequence CCGGGCCAGAAAGAGGAGCCCAG CCCAGAGGAGAGCTGGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 32, 4: 394} {0: 1, 1: 0, 2: 7, 3: 95, 4: 754}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!