ID: 1150637092_1150637101

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1150637092 1150637101
Species Human (GRCh38) Human (GRCh38)
Location 17:66920978-66921000 17:66921028-66921050
Sequence CCAGTAAGAGATGAAGTCATCGA GCTTGTCTTGCATTGGCCAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 19, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!