ID: 1150865504_1150865511

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1150865504 1150865511
Species Human (GRCh38) Human (GRCh38)
Location 17:68845145-68845167 17:68845175-68845197
Sequence CCCCATCGTCTCAGCCCCAAAAC CCTGATAAGCAACTTCAGCAAGG
Strand - +
Off-target summary {0: 45, 1: 520, 2: 4124, 3: 8775, 4: 3937} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!