ID: 1150865506_1150865511

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1150865506 1150865511
Species Human (GRCh38) Human (GRCh38)
Location 17:68845147-68845169 17:68845175-68845197
Sequence CCATCGTCTCAGCCCCAAAACTC CCTGATAAGCAACTTCAGCAAGG
Strand - +
Off-target summary {0: 50, 1: 511, 2: 4158, 3: 8916, 4: 4203} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!