ID: 1151360405_1151360409

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1151360405 1151360409
Species Human (GRCh38) Human (GRCh38)
Location 17:73585227-73585249 17:73585261-73585283
Sequence CCAGAACTGTCTCAGAATGCACT ATGCCATGCGCTTCTCGTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 178} {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!