ID: 1151668282_1151668287

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1151668282 1151668287
Species Human (GRCh38) Human (GRCh38)
Location 17:75557964-75557986 17:75557988-75558010
Sequence CCTGGTGCCCCAGGGCCAGGGCT CTGTGTCTCCTCCCCACCCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 67, 4: 636} {0: 1, 1: 0, 2: 7, 3: 46, 4: 451}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!