ID: 1151680251_1151680258

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1151680251 1151680258
Species Human (GRCh38) Human (GRCh38)
Location 17:75619312-75619334 17:75619339-75619361
Sequence CCCCTCTGTGTGAGCAGAGGGCA GGGTCCTTCCTGCCCACAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 27, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!