ID: 1151812491_1151812498

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1151812491 1151812498
Species Human (GRCh38) Human (GRCh38)
Location 17:76452819-76452841 17:76452835-76452857
Sequence CCCGCGCCCCCGGCCTCGGAGCA CGGAGCACCCCGAGCTCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 351} {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!