ID: 1151816416_1151816425

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1151816416 1151816425
Species Human (GRCh38) Human (GRCh38)
Location 17:76473585-76473607 17:76473605-76473627
Sequence CCACAGGAAGCCGCAGCTCGGGG GGGGGGCAGTGGGATGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 211} {0: 1, 1: 0, 2: 7, 3: 83, 4: 861}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!