ID: 1151929818_1151929822

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1151929818 1151929822
Species Human (GRCh38) Human (GRCh38)
Location 17:77225291-77225313 17:77225308-77225330
Sequence CCATCCTCATTCTGCTAATAAGG ATAAGGACATACCCAAGACTGGG
Strand - +
Off-target summary No data {0: 69, 1: 2378, 2: 4319, 3: 7516, 4: 8981}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!