ID: 1152049225_1152049243

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1152049225 1152049243
Species Human (GRCh38) Human (GRCh38)
Location 17:77959215-77959237 17:77959256-77959278
Sequence CCCGCGCCACCGGAGCCCCGCGG GGACGGAGCCCAGGTGAGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 240} {0: 1, 1: 1, 2: 2, 3: 26, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!