ID: 1152097812_1152097825

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1152097812 1152097825
Species Human (GRCh38) Human (GRCh38)
Location 17:78282109-78282131 17:78282162-78282184
Sequence CCTGTAATCCCAGCACTTTGGGA TATCGAGATCAGGCCGGGCACGG
Strand - +
Off-target summary {0: 284556, 1: 262309, 2: 153276, 3: 130613, 4: 189623} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!