ID: 1152097814_1152097825

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1152097814 1152097825
Species Human (GRCh38) Human (GRCh38)
Location 17:78282117-78282139 17:78282162-78282184
Sequence CCCAGCACTTTGGGAGGCCAAGG TATCGAGATCAGGCCGGGCACGG
Strand - +
Off-target summary {0: 84285, 1: 209100, 2: 236161, 3: 152470, 4: 88713} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!