ID: 1152124515_1152124530

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1152124515 1152124530
Species Human (GRCh38) Human (GRCh38)
Location 17:78438276-78438298 17:78438324-78438346
Sequence CCCAGAGGCGCTCGAGGACAAGC GCTCCAGGGCTGAGGAGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59} {0: 1, 1: 0, 2: 5, 3: 116, 4: 1339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!