ID: 1152129527_1152129536

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1152129527 1152129536
Species Human (GRCh38) Human (GRCh38)
Location 17:78467491-78467513 17:78467542-78467564
Sequence CCTATCAGGGGATGCCTTTGGCT GCAGCCCGCAGAGGGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101} {0: 1, 1: 1, 2: 5, 3: 56, 4: 566}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!