ID: 1152261352_1152261360

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1152261352 1152261360
Species Human (GRCh38) Human (GRCh38)
Location 17:79268966-79268988 17:79268999-79269021
Sequence CCCCCCAAATTCATGTCTACCTA ATGTGACCTCATTTGGAAATAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 30, 3: 111, 4: 414} {0: 27, 1: 518, 2: 1309, 3: 1883, 4: 2769}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!