ID: 1152274140_1152274143

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1152274140 1152274143
Species Human (GRCh38) Human (GRCh38)
Location 17:79344475-79344497 17:79344495-79344517
Sequence CCTTCCTCATTGGGCTTCTCAAT AATCATTTTCCTGCAGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 195} {0: 1, 1: 0, 2: 1, 3: 34, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!