ID: 1152419665_1152419674

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1152419665 1152419674
Species Human (GRCh38) Human (GRCh38)
Location 17:80185615-80185637 17:80185663-80185685
Sequence CCGCCTGTGTTCTGGTTTTCTCA CTTTCCCCCAGCCCAGGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 601} {0: 1, 1: 0, 2: 1, 3: 43, 4: 416}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!