ID: 1152438008_1152438022

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1152438008 1152438022
Species Human (GRCh38) Human (GRCh38)
Location 17:80288039-80288061 17:80288075-80288097
Sequence CCTCTCCGCGCCCACCGAGGTTG GCAGGCCCAGGCTTTGGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47} {0: 1, 1: 1, 2: 3, 3: 47, 4: 491}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!