ID: 1152456830_1152456840

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1152456830 1152456840
Species Human (GRCh38) Human (GRCh38)
Location 17:80421636-80421658 17:80421685-80421707
Sequence CCACCAATTTGCAGGGTACATCT TCTCATAGGTGAGGCAGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 94} {0: 1, 1: 0, 2: 1, 3: 31, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!