ID: 1152532548_1152532557

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1152532548 1152532557
Species Human (GRCh38) Human (GRCh38)
Location 17:80927834-80927856 17:80927869-80927891
Sequence CCTCATCTCCTCCATTTGCACAT GCCCGCACGGAGGAGCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 385} {0: 1, 1: 0, 2: 0, 3: 11, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!