ID: 1152532550_1152532561

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1152532550 1152532561
Species Human (GRCh38) Human (GRCh38)
Location 17:80927845-80927867 17:80927888-80927910
Sequence CCATTTGCACATCTGAGAATTCC AGGGTGTCAGCCTTGTGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 240} {0: 1, 1: 0, 2: 0, 3: 23, 4: 483}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!