|
Left Crispr |
Right Crispr |
| Crispr ID |
1152551993 |
1152552002 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:81034767-81034789
|
17:81034784-81034806
|
| Sequence |
CCTGCGCCACCCCGCCCCCGCCT |
CCGCCTCCCCGCCCCCAGCCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 17, 3: 189, 4: 1474} |
{0: 1, 1: 4, 2: 26, 3: 200, 4: 1343} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|