ID: 1152594452_1152594466

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1152594452 1152594466
Species Human (GRCh38) Human (GRCh38)
Location 17:81231657-81231679 17:81231696-81231718
Sequence CCTGCTGACAGTCACTCAGGGCC CAGGGGGAATGGCCGGGTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 191} {0: 1, 1: 0, 2: 1, 3: 14, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!