ID: 1152594454_1152594468

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1152594454 1152594468
Species Human (GRCh38) Human (GRCh38)
Location 17:81231678-81231700 17:81231704-81231726
Sequence CCACCACCTCGACCCTGCCAGGG ATGGCCGGGTCAAGGGTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 337} {0: 1, 1: 0, 2: 0, 3: 10, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!