ID: 1152594470_1152594472

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1152594470 1152594472
Species Human (GRCh38) Human (GRCh38)
Location 17:81231708-81231730 17:81231734-81231756
Sequence CCGGGTCAAGGGTGAGTGGAGGC GCCCCCACTCCTGTCTCGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 138} {0: 1, 1: 0, 2: 0, 3: 22, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!